Gene name |
SPAC1805.14 |
Gene ID |
21/A11 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
1359 |
ORF length (spliced) |
|
Entry clone length |
1359 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
585T:C / 586T:C /
1247A:G / 1297A:G / 1300T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1805.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCGAAGAAATACCCT |
Rev primer name |
SPAC1805.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTTTTTTTTCTCAAGGGA |
Amino acid length |
452 |
Molecular weight |
50.9 |
Isoelectric point (calc.) |
4.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
53 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol; nuclear dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |