| Gene name |
SPBC18A7.01 |
| Gene ID |
21/A09 |
| Gene synonyms/obsolete |
SPBC4F6.19c |
| Gene product |
aminopeptidase;
dipeptidase; metallopeptidase; peptidase family M24; no
apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1356 |
| ORF length (spliced) |
|
| Entry clone length |
1356 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1241A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC18A7.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTTCTTTTGAATCAAG |
| Rev primer name |
SPBC18A7.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGGCTCGTAGGGACTTTTT |
| Amino acid length |
451 |
| Molecular weight |
50.5 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLALSFLSL/LYDRLGPLKL |
| Localization (YFP) |
ER; Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |