| Gene name |
SPBC4F6.02c |
| Gene ID |
20/F10 |
| Gene synonyms/obsolete |
SPBC3E7.15c |
| Gene product |
LAG1 domain; lipid
sensing domain; involved in ceramide synthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1336 |
| ORF length (spliced) |
1155 |
| Entry clone length |
1336 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
640T:C / 1080G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC4F6.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAATAATACCTCGAG |
| Rev primer name |
SPBC4F6.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATTCTTTTTAGCGGAC |
| Amino acid length |
384 |
| Molecular weight |
45.3 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LILLTALQL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |