| Gene name |
SPCC126.06 |
| Gene ID |
20/F05 |
| Gene synonyms/obsolete |
twf1 |
| Gene product |
twinfilin; actin
cortical patch component; actin-binding protein; ADF family;
cofilin/tropomyosin-type; putative actin monomer sequestering
protein involved in regulation of the cortical actin
cytoskeleton; possibly prevents actin filament assembly;
involved in actin cortical patch distribution (pers. comm.
David R. Kovar and Thomas D. Pollard); non-essential (pers.
comm. David R. Kovar and Thomas D. Pollard) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1333 |
| ORF length (spliced) |
987 |
| Entry clone length |
1333 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
961G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC126.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCTTCCGTCGAATT |
| Rev primer name |
SPCC126.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGTCTTCTAGGGGGTCGA |
| Amino acid length |
328 |
| Molecular weight |
36.7 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLDSIKAELGI |
| Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |