Gene name |
SPAC9G1.04 |
Gene ID |
20/C03 |
Gene synonyms/obsolete |
oxa101; oxa1; oxa1-1;
cox18; oxa1sp1 |
Gene product |
respiratory complex
biogenesis protein; cytochrome c oxidase assembly protein;
localization mitochondrial inner membrane; similar to Sp
oxa102 (paralog); essential with oxa102 |
Entry clone |
Cloned |
ORF length (unspliced) |
1266 |
ORF length (spliced) |
1125 |
Entry clone length |
1266 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
317T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC9G1.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTACATTTTCTAATTAG |
Rev primer name |
SPAC9G1.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTACTTTGCTTCTTTGAA |
Amino acid length |
374 |
Molecular weight |
42 |
Isoelectric point (calc.) |
10.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTLGVRLAL/LAWFKDLSI |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |