| Gene name |
SPBC21B10.07 |
| Gene ID |
20/B05 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl hydrolase
family 16; glucanase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1260 |
| ORF length (spliced) |
|
| Entry clone length |
1260 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21B10.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTATTCCTGATTCCAC |
| Rev primer name |
SPBC21B10.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTATTGATAAACGGCCAAG |
| Amino acid length |
419 |
| Molecular weight |
46.5 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |