Gene name |
SPBC18H10.15 |
Gene ID |
20/A05 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1255 |
ORF length (spliced) |
1197 |
Entry clone length |
1255 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
302C:T / 454A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC18H10.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGGCTCCAAGTGGGA |
Rev primer name |
SPBC18H10.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTCTTTGGAGATGCACTA |
Amino acid length |
398 |
Molecular weight |
46.1 |
Isoelectric point (calc.) |
8.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
32/27 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQSEVKTLML |
Localization (YFP) |
nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |