Gene name |
SPAC8F11.04 |
Gene ID |
19/H12 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; hypothetical protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1249 |
ORF length (spliced) |
1122 |
Entry clone length |
1249 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
1189A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC8F11.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTAAAAGAATTATT |
Rev primer name |
SPAC8F11.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTGCTTTACCTTATTCTTT |
Amino acid length |
373 |
Molecular weight |
41.3 |
Isoelectric point (calc.) |
10.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleolus>>nucleus |
Microscope used for
observation |
Confocal
|