| Gene name |
SPCC1795.03 |
| Gene ID |
19/G06 |
| Gene synonyms/obsolete |
gms1 |
| Gene product |
UDP-galactose
transporter; essential; involved in protein galactosylation
(required); essential for the transport of UDP-galactose into
the lumen of Golgi apparatus; belongs to the nucleotide-sugar
transporter family. SLC35A subfamily; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1237 |
| ORF length (spliced) |
1062 |
| Entry clone length |
1237 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1795.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGTCAAGGGCGACGA |
| Rev primer name |
SPCC1795.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGCTTATGATCAACGTCC |
| Amino acid length |
353 |
| Molecular weight |
39.1 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTAIFSILLL/LTFLIGVMLVI |
| Localization (YFP) |
nucleus; nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |