| Gene name |
SPAC1F12.01c |
| Gene ID |
19/D12 |
| Gene synonyms/obsolete |
SPAC1556.08c |
| Gene product |
involved in glucose
derepression; 5'-AMP-activated (gamma subunit) (#needs check);
CBS domain protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1224 |
| ORF length (spliced) |
1005 |
| Entry clone length |
1224 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
143T:C / 813T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F12.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGACGTTCAAGAGAC |
| Rev primer name |
SPAC1F12.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACGGCAGATTCAAAATTA |
| Amino acid length |
334 |
| Molecular weight |
37.4 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFVVDENLKL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |