Gene name |
SPAC57A10.01 |
Gene ID |
19/D07 |
Gene synonyms/obsolete |
pas1;
SPAC19E9.03 |
Gene product |
Pcl-like cyclin;
involved in start control point of mitotic cell cycle;
activator of the Res2p-Cdc10p transcriptional factor
complex |
Entry clone |
Cloned |
ORF length (unspliced) |
1221 |
ORF length (spliced) |
|
Entry clone length |
1221 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
98T:C / 818T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC57A10.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGAGCTTTGCTCGAGTC |
Rev primer name |
SPAC57A10.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGTAACTGCGACGCTTA |
Amino acid length |
411 |
Molecular weight |
45.3 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |