Gene name |
SPCC777.07 |
Gene ID |
19/D02 |
Gene synonyms/obsolete |
|
Gene product |
glycosyl transferase
family 15; similar to S. cerevisiae YOR099W and YKR061W
and YJL139C and YDR483W and YBR205W and YBR199W and YPL053C;
conserved fungal protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1217 |
ORF length (spliced) |
1137 |
Entry clone length |
1217 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC777.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCATACCCAAATCATC |
Rev primer name |
SPCC777.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTATTGATGTTTTCTAAC |
Amino acid length |
378 |
Molecular weight |
44.4 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|