Gene name |
SPBC1709.14 |
Gene ID |
19/C09 |
Gene synonyms/obsolete |
|
Gene product |
peptide N-glycanase;
involved in deglycosylation; involved in proteasome-dependent
pathway |
Entry clone |
Cloned in 2004
trial_also cloned#/ 3' FS at 1st |
ORF length (unspliced) |
1213 |
ORF length (spliced) |
1002 |
Entry clone length |
1213 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC1709.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTTCATGCGATTTC |
Rev primer name |
SPBC1709.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTTTCCTGCTTCCCCTCTT |
Amino acid length |
333 |
Molecular weight |
39.2 |
Isoelectric point (calc.) |
5.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol;
nuclear envelope |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol; nuclear envelope |
Microscope used for
observation |
DeltaVision |