| Gene name |
SPAC23H3.04 |
| Gene ID |
19/C03 |
| Gene synonyms/obsolete |
|
| Gene product |
Sp specific families;
hypothetical protein; similar to Sp SPAC1952.10C
(paralog) |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1202 |
| ORF length (spliced) |
903 |
| Entry clone length |
1202 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
124T:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23H3.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTTGGGATTTTAAACA |
| Rev primer name |
SPAC23H3.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATACAGTACTCTTTCAGA |
| Amino acid length |
300 |
| Molecular weight |
34.6 |
| Isoelectric point (calc.) |
9.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLCIHVALFI/LVLPLTVLIL |
| Localization (YFP) |
Golgi |
| Comments for localization |
Golgi layer |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |