Gene name |
SPCC1281.05 |
Gene ID |
18/F02 |
Gene synonyms/obsolete |
|
Gene product |
involved in protein
targeting; involved in protein-nucleus import |
Entry clone |
Cloned |
ORF length (unspliced) |
1173 |
ORF length (spliced) |
|
Entry clone length |
1173 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
858T:C / 1102C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1281.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTACGGCTGGCTC |
Rev primer name |
SPCC1281.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTACATGCTATTCAAACGA |
Amino acid length |
390 |
Molecular weight |
44 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
263 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|