| Gene name |
SPBC1734.06 |
| Gene ID |
18/D06 |
| Gene synonyms/obsolete |
rhp18 |
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); SAP
domain; DNA-binding protein; involved in DNA repair; involved
in post-replication repair; required for DNA damage responses
throughout the cell cycle |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1164 |
| ORF length (spliced) |
|
| Entry clone length |
1164 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1734.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGAACTAGATGCTAC |
| Rev primer name |
SPBC1734.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGACTGTGGTCCATCGGAT |
| Amino acid length |
387 |
| Molecular weight |
43.4 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|