| Gene name |
SPAC23C4.08 |
| Gene ID |
18/D04 |
| Gene synonyms/obsolete |
rho3 |
| Gene product |
Rho family; small
GTPase; involved in cellular morphogenesis; involved in
septation; involved in microtubule cytoskeleton organization
and biogenesis (IMP); involved in actin cytoskeleton
organization and biogenesis; involved in regulation of the
actin cytoskeleton; involved in exocytosis (IMP); interacts
physically with Myo2p; interacts physically with Exo70p;
involved in cell polarity; interacts physically with For3p;
C-terminal CAAX motif; involved in cytokinesis; involved in
cytokinesis, cell separation (regulation) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1164 |
| ORF length (spliced) |
627 |
| Entry clone length |
1164 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
179C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23C4.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTTCGCTAAGCAGTA |
| Rev primer name |
SPAC23C4.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAATGATACATCCGGTA |
| Amino acid length |
208 |
| Molecular weight |
22.8 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|