| Gene name |
SPAC4C5.04 |
| Gene ID |
18/C10 |
| Gene synonyms/obsolete |
uba4; rad31 |
| Gene product |
ubiquitin activating
enzyme; UBA-related protein; involved in DNA repair; involved
in DNA damage resistance (required); ubiquitin activating
enzyme; mutant (rad31-1) displays defects in cell morphology;
mutant displays defects in nuclear division (rad31-1);
non-essential; deletion mutant results in slow growth;
interacts genetically with hus5; functionally complemented by
Sc YPR180W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1161 |
| ORF length (spliced) |
924 |
| Entry clone length |
1161 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4C5.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAATCACAATATTAA |
| Rev primer name |
SPAC4C5.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAACGATAAATTGGAGCA |
| Amino acid length |
307 |
| Molecular weight |
34.7 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LANEIAKNLVL |
| Localization (YFP) |
nucleus>=cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |