| Gene name |
SPCC306.05c |
| Gene ID |
18/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
INSIG domain; no
apparent Sc ortholog; conserved in human and rat; involved in
control of sterol homeostasis (possibly) (pers. comm. P.
Espenshade) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1154 |
| ORF length (spliced) |
846 |
| Entry clone length |
1154 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC306.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAGAAAAGAGATTTA |
| Rev primer name |
SPCC306.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATAGTAGACGACCAGCG |
| Amino acid length |
281 |
| Molecular weight |
31.8 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSGLFAPLKL/LAAFATLLL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|