| Gene name |
SPBC30B4.09c |
| Gene ID |
18/B07 |
| Gene synonyms/obsolete |
SPBC27B12.01c;
SPBC30B4.09a |
| Gene product |
mitochondrial outer
membrane protein; involved in mitochondrial biogenesis;
involved in coupling mitochondria to the actin cytoskeleton
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1149 |
| ORF length (spliced) |
1041 |
| Entry clone length |
1149 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC30B4.09a.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATACACCTGCCGCAGGG |
| Rev primer name |
SPBC30B4.09a.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTCATTAGATGACTCC |
| Amino acid length |
346 |
| Molecular weight |
38.8 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; cytoplasmic
dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |