| Gene name |
SPBC317.01 |
| Gene ID |
17/F05 |
| Gene synonyms/obsolete |
|
| Gene product |
MADS-box transcription
factor; SRF-type transcription factor; involved in cell wall
biosynthesis; deletion mutant galactomannans deficient for
pyruvylated galactose-beta-1, 3-galactose-alpha-1,2-pyruvate
(Pv) (pers. comm. Robert Trimble) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1119 |
| ORF length (spliced) |
|
| Entry clone length |
1119 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
699T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC317.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGCGCAAAAAAATCTC |
| Rev primer name |
SPBC317.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTATTTGACATCACTGAGT |
| Amino acid length |
372 |
| Molecular weight |
41.5 |
| Isoelectric point (calc.) |
7.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQQLNTLSI |
| Localization (YFP) |
nucleus>>cytosol; nuclear envelope? |
| Comments for localization |
a lot of cytoplasmic
dots and nuclear dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |