Gene name |
SPBC15C4.01c |
Gene ID |
17/E07 |
Gene synonyms/obsolete |
oca3;
SPBC14C8.18c |
Gene product |
eukaryotic conserved
protein; TPR repeat protein; overexpression results in cell
cycle defects |
Entry clone |
Cloned in 2004
trial_also cloned#/ 3' FS at 1st |
ORF length (unspliced) |
1113 |
ORF length (spliced) |
849 |
Entry clone length |
1113 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC15C4.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCAATAGTATTCTTAA |
Rev primer name |
SPBC15C4.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCATTGCTCCAATAAAGCC |
Amino acid length |
282 |
Molecular weight |
32.8 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nuclear dots;
nucleus>cytosol; periphery at site of septum
formation? |
Comments for localization |
ER? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |