| Gene name |
SPCC1281.08 |
| Gene ID |
17/C01 |
| Gene synonyms/obsolete |
wtf11 |
| Gene product |
wtf element |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
1098 |
| ORF length (spliced) |
795 |
| Entry clone length |
1098 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1281.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAGCAATTACGTTCC |
| Rev primer name |
SPCC1281.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAATTCATCTGAATCTTCA |
| Amino acid length |
264 |
| Molecular weight |
29.9 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
a few cytoplasmic
dots; Golgi? |
| Comments for localization |
Golgi?; moving small
cytoplasmic dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |