| Gene name |
SPAC644.14c |
| Gene ID |
17/B11 |
| Gene synonyms/obsolete |
rad51; rhp51 |
| Gene product |
RecA-like protein;
involved in DNA repair; interacts physically with Rad22p;
involved in meiotic recombination; involved in meiotic gene
conversion (required); AAA family ATPase; helix-hairpin-helix;
DNA-binding protein; telomere binding; involved telomere
maintenance (in the absence of Ku) (required); AAA family
ATPase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1098 |
| ORF length (spliced) |
|
| Entry clone length |
1098 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC644.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGATACAGAGGTGGA |
| Rev primer name |
SPAC644.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGACAGGTGCGATAATTTCC |
| Amino acid length |
365 |
| Molecular weight |
39.8 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots; nuclear
envelope; nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |