Gene name |
SPAC186.03 |
Gene ID |
16/H02 |
Gene synonyms/obsolete |
|
Gene product |
L-asparaginase;
similar to Sp SPAC977.12 and SPBPB8B6.05c and SPBPB21E7.09
|
Entry clone |
Cloned |
ORF length (unspliced) |
1083 |
ORF length (spliced) |
|
Entry clone length |
1083 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
390T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC186.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGGAGATCAATAATCAG |
Rev primer name |
SPAC186.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACTCAAGGCTGAATATA |
Amino acid length |
360 |
Molecular weight |
38.7 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ambiguous structure;
Golgi? |
Comments for localization |
ER-Golgi? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |