| Gene name |
SPAC18G6.07c |
| Gene ID |
16/G05 |
| Gene synonyms/obsolete |
mra1 |
| Gene product |
downstream factor of
Ras; involved in cell growth (required); involved in
conjugation (required); involved in ribosome biogenesis and
assembly |
| Entry clone |
Cloned in 2004
trial |
| ORF length (unspliced) |
1080 |
| ORF length (spliced) |
|
| Entry clone length |
1080 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC18G6.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTACTTATTCCAAAAG |
| Rev primer name |
SPAC18G6.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATACAATTCCTAGAAAGTCT |
| Amino acid length |
359 |
| Molecular weight |
39.7 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMVQLLHKLSI/LHSMEDFLGI |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
| Microscope used for
observation |
DeltaVision |