| Gene name |
SPAC57A10.04 |
| Gene ID |
16/G02 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
sequence orphan; low similarity to RhoGEF |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1080 |
| ORF length (spliced) |
1017 |
| Entry clone length |
1080 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
184A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC57A10.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCAATCATAAGGTCTCT |
| Rev primer name |
SPAC57A10.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGTTTTAGCATTGACAACT |
| Amino acid length |
338 |
| Molecular weight |
38.4 |
| Isoelectric point (calc.) |
9.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |