| Gene name |
SPAC11G7.03 |
| Gene ID |
16/E04 |
| Gene synonyms/obsolete |
idh1; glu3 |
| Gene product |
isocitrate
dehydrogenase (NAD+) subunit 1; involved in tricarboxylic acid
cycle; involved in isocitrate metabolism; involved in
glutamate biosynthesis; isocitrate dehydrogenase (NAD+)
activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1071 |
| ORF length (spliced) |
|
| Entry clone length |
1071 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC11G7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCAAATCACTAGTAAG |
| Rev primer name |
SPAC11G7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAGCTTTCCATTCTTTCT |
| Amino acid length |
356 |
| Molecular weight |
38.7 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |