Gene name |
SPAP27G11.02 |
Gene ID |
16/E02 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; TPR repeat protein |
Entry clone |
Cloned |
ORF length (unspliced) |
1071 |
ORF length (spliced) |
|
Entry clone length |
1071 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
291C:T / 428T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAP27G11.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTATGCAATGGATTTG |
Rev primer name |
SPAP27G11.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGTAGGAGAGGAGGAT |
Amino acid length |
356 |
Molecular weight |
40.5 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIELSEPLGL |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |