| Gene name |
SPAC2E1P5.04c |
| Gene ID |
16/D04 |
| Gene synonyms/obsolete |
cwg2 |
| Gene product |
geranylgeranyltransferase type I (GGTase I), beta
subunit; required for beta-glucan synthesis; interacts
physically with Cwp1p; involved in the post-translational
C-terminal modification of several small GTPases, allowing
their targeting to the membrane |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1068 |
| ORF length (spliced) |
|
| Entry clone length |
1068 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
86A:G / 675T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC2E1P5.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTAACAAGAGCTAA |
| Rev primer name |
SPAC2E1P5.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTCCCCTTGGCTGCTTGA |
| Amino acid length |
355 |
| Molecular weight |
40 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYGLALQLAL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |