Gene name |
SPCC553.10 |
Gene ID |
16/A08 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
serine-rich protein; hypothetical protein; GPI anchored
protein (pers. comm. Birgit Eisenhaber); glycoprotein; no
apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1050 |
ORF length (spliced) |
|
Entry clone length |
1050 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
400T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC553.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGTTCAAAATTTCCTT |
Rev primer name |
SPCC553.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGAGTGAGAGAGAGAGCG |
Amino acid length |
349 |
Molecular weight |
35.9 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFKISFLAL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |