Gene name |
SPAC14C4.06c |
Gene ID |
15/A09 |
Gene synonyms/obsolete |
|
Gene product |
zinc finger protein
(inferred); involved in nuclear export; involved in poly(A)+
mRNA-nucleus export; RNA-binding protein; poly(A) binding
|
Entry clone |
Cloned# |
ORF length (unspliced) |
1013 |
ORF length (spliced) |
924 |
Entry clone length |
1013 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC14C4.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTACATTACTGGAAAC |
Rev primer name |
SPAC14C4.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACACAGAAGGAACATGAAGT |
Amino acid length |
307 |
Molecular weight |
33.9 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots; nuclear
envelope?; nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |