| Gene name |
SPBC30D10.16 |
| Gene ID |
14/H12 |
| Gene synonyms/obsolete |
|
| Gene product |
chorismate mutase;
phrenate dehydratase; involved in phenylalanine biosynthesis
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1009 |
| ORF length (spliced) |
864 |
| Entry clone length |
1009 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
575A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC30D10.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGCTTCAAAAATTGC |
| Rev primer name |
SPBC30D10.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAATAACTGATTTGGTTG |
| Amino acid length |
287 |
| Molecular weight |
31.5 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |