| Gene name |
SPCC1442.10c |
| Gene ID |
14/B12 |
| Gene synonyms/obsolete |
rpb3 |
| Gene product |
DNA-directed RNA
polymerase II (subunit 3); involved in transcription from Pol
II promoter; DNA-directed RNA polymerase activity (function of
complex); DNA-binding activity (function of complex);
interacts physically with Rpb2p; interacts physically with
Rpb11p; interacts physically with Rpb10p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
982 |
| ORF length (spliced) |
894 |
| Entry clone length |
982 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
9A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1442.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCAGAAACGCATAT |
| Rev primer name |
SPCC1442.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCACGTGTTTTCTTCACCA |
| Amino acid length |
297 |
| Molecular weight |
33.7 |
| Isoelectric point (calc.) |
4.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |