| Gene name |
SPBC13E7.09 |
| Gene ID |
14/B09 |
| Gene synonyms/obsolete |
|
| Gene product |
verprolin;
proline-rich protein; involved in actin cytoskeletal
organization; actin cortical patch component; Wiskott-Aldrich
homolog; involved in endocytosis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
982 |
| ORF length (spliced) |
930 |
| Entry clone length |
982 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
11C:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC13E7.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACCTGCACCACCGCC |
| Rev primer name |
SPBC13E7.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAATGAAGAGAGATTCAAA |
| Amino acid length |
309 |
| Molecular weight |
31.2 |
| Isoelectric point (calc.) |
11.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |