| Gene name |
SPBC1718.05 |
| Gene ID |
14/B07 |
| Gene synonyms/obsolete |
trs31 |
| Gene product |
TRAPP plays a key role
in the late stages of endoplasmic reticulum to Golgi traffic;
Similarity Belongs to the TRAPP small subunits family; BET3
subfamily. |
| Entry clone |
Cloned |
| ORF length (unspliced) |
981 |
| ORF length (spliced) |
630 |
| Entry clone length |
981 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
83T:C / 518T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1718.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAATCCACTAATAAAGA |
| Rev primer name |
SPBC1718.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCCAAAACTTCCTCTCTA |
| Amino acid length |
209 |
| Molecular weight |
23.8 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol;
nuclear envelope? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |