| Gene name |
SPBC12C2.09c |
| Gene ID |
14/A02 |
| Gene synonyms/obsolete |
|
| Gene product |
UPF0073; involved in
lipid homeostasis; involved in phosphate homeostasis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
975 |
| ORF length (spliced) |
|
| Entry clone length |
975 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
165A:G / 686T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC12C2.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAATCAGAGCAGTT |
| Rev primer name |
SPBC12C2.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATTTCTCCACAACCACGC |
| Amino acid length |
324 |
| Molecular weight |
37.1 |
| Isoelectric point (calc.) |
7.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFFIFKSELIL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |