| Gene name |
SPBC14C8.16c |
| Gene ID |
13/C12 |
| Gene synonyms/obsolete |
bot1 |
| Gene product |
involved in growth
site determination (unpublished); interacts physically with
Tea1p (unpublished); interacts physically with Orb6p
(unpublished); mitochondrial ribosomal small subunit
(putative) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
948 |
| ORF length (spliced) |
|
| Entry clone length |
948 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
147A:G / 440G:A /
514A:G / 863G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC14C8.16.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGAATTCAGTGGAATT |
| Rev primer name |
SPBC14C8.16.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGTAGTAGATTTTTTTCTC |
| Amino acid length |
315 |
| Molecular weight |
35.7 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |