| Gene name |
SPCC191.12c |
| Gene ID |
13/C04 |
| Gene synonyms/obsolete |
SPCC1450.01c |
| Gene product |
putative
pseudogene |
| Entry clone |
Cloned |
| ORF length (unspliced) |
944 |
| ORF length (spliced) |
|
| Entry clone length |
944 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
Cloned but is a
putative pseudogene. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC191.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGCAGGAATCAAGTC |
| Rev primer name |
SPCC191.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCTAGTTAATGTCGTAACA |
| Amino acid length |
|
| Molecular weight |
|
| Isoelectric point (calc.) |
|
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |