| Gene name |
SPAC821.01 |
| Gene ID |
13/A01 |
| Gene synonyms/obsolete |
meu13;
SPAC222.15 |
| Gene product |
meiosis specific
transcript; involved in pairing of homologous chromosomes in
meiosis (implicated); meiotic expression upregulated; mutant
displays decreased meiotic recombination; promotes homologous
pairing independently of homologous recombination |
| Entry clone |
Cloned |
| ORF length (unspliced) |
929 |
| ORF length (spliced) |
651 |
| Entry clone length |
929 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
281T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC821.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTAAGGCGAAAGAAGT |
| Rev primer name |
SPAC821.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTTAAGTCAATTGGTCCC |
| Amino acid length |
216 |
| Molecular weight |
24.6 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; spindle
microtubules; nucleus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss, DeltaVision
|