| Gene name |
SPAC31G5.13 |
| Gene ID |
12/H09 |
| Gene synonyms/obsolete |
rpn11; pad1; sks1;
bfr2 |
| Gene product |
19S proteasome
regulatory subunit; MOV34 domain; essential; positive
regulator of pap1 dependent transcription; involved in the
maintenance of chromosome structure; overexpression confers
multidrug resistance; involved in deubiquitination |
| Entry clone |
Cloned |
| ORF length (unspliced) |
927 |
| ORF length (spliced) |
|
| Entry clone length |
927 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC31G5.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATCTTTACAAAGATT |
| Rev primer name |
SPAC31G5.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAGGCAACGGAATCAAGC |
| Amino acid length |
308 |
| Molecular weight |
34.5 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEEIMLLNL |
| Localization (YFP) |
cytoplasmic dots;
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |