| Gene name |
SPCC338.11c |
| Gene ID |
12/F06 |
| Gene synonyms/obsolete |
uvi22; rrg1 |
| Gene product |
experimentally
characterised; UV-induced protein; transcriptionally regulated
by glucose; regulated post transcriptionally by control of
mRNA stability; deletion mutant results in reduced size;
non-essential; overexpression results in elongated cells of G2
delay; involved in G2/M phase progression; regulated by the
SAPK pathway |
| Entry clone |
Cloned |
| ORF length (unspliced) |
912 |
| ORF length (spliced) |
|
| Entry clone length |
912 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
393A:T / 791T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC338.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTTAGAAGACACGGA |
| Rev primer name |
SPCC338.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCATGGTATTTCCATCTA |
| Amino acid length |
303 |
| Molecular weight |
34.5 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSNSINALEL |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |