| Gene name |
SPBC1347.08c |
| Gene ID |
12/A01 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved eukaryotic
protein; low similarity to human HEMBA1005185, D. melanogaster
CG11164, and C. elegans F21D5.6.; conserved motif
{R/H}S{W/F}{VIY}...V.{S/E}.G.{L/I}{H/Y}..{T/A}P{V/I}{D/N}
{L/P}; no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
882 |
| ORF length (spliced) |
|
| Entry clone length |
882 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
61T:C / 119A:G /
132T:C / 138T:C / 571T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1347.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGGGAAAGATATTCAT |
| Rev primer name |
SPBC1347.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTTTTTGTAAAGAATGAA |
| Amino acid length |
293 |
| Molecular weight |
33.7 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKKQLAPLDL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
nuclear dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |