| Gene name |
SPBC2D10.02 |
| Gene ID |
11/C03 |
| Gene synonyms/obsolete |
orc6; SPBC2A9.12 |
| Gene product |
origin recognition
complex (subunit 6) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
853 |
| ORF length (spliced) |
795 |
| Entry clone length |
853 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
137A:G / 331A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC2D10.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGCGACAACAGATTAT |
| Rev primer name |
SPBC2D10.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGAAGCAGTACCATCTTTT |
| Amino acid length |
264 |
| Molecular weight |
30.7 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>=cytosol;
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol; nuclear dots |
| Microscope used for
observation |
DeltaVision |