| Gene name |
SPAC17C9.14 |
| Gene ID |
11/A05 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in peroxisome
biogenesis; farnesylated protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
841 |
| ORF length (spliced) |
699 |
| Entry clone length |
841 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
251T:C / 480A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17C9.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAATCCAACTATTGA |
| Rev primer name |
SPAC17C9.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGGGTTGGACATCCTGCA |
| Amino acid length |
232 |
| Molecular weight |
26.1 |
| Isoelectric point (calc.) |
4 |
| Signal SEQ |
|
| No. of transmembrane domain |
13 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |