| Gene name |
SPAC4C5.02c |
| Gene ID |
11/A03 |
| Gene synonyms/obsolete |
ryh1; hos1 |
| Gene product |
small GTPase; Rab
family; GTP-binding protein; Protein transport; Might
participate in post-Golgi transport; non-essential; deletion
mutant is temperature sensitive for growth, sensitive to
osmotic stress and severely sterile; C-terminal CXC
prenylation site; similar to S. cerevisiae
YLR262C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
840 |
| ORF length (spliced) |
606 |
| Entry clone length |
840 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
226T:C / 642A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC4C5.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAAATTACTCGTT |
| Rev primer name |
SPAC4C5.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCAATTGCAGCTGCTTTCA |
| Amino acid length |
201 |
| Molecular weight |
23.1 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |