| Gene name |
SPBC1734.05c |
| Gene ID |
10/G08 |
| Gene synonyms/obsolete |
spf31 |
| Gene product |
spliceosome associated
protein; DNAJ domain protein; involved in mRNA splicing; no
apparent Sc ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
833 |
| ORF length (spliced) |
630 |
| Entry clone length |
833 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
148T:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1734.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGACGTTGCAAAGTT |
| Rev primer name |
SPBC1734.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCAAGAACCCTTGGTTTT |
| Amino acid length |
209 |
| Molecular weight |
24.6 |
| Isoelectric point (calc.) |
10.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
164 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
bright signal |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |