Gene name |
SPAC1527.02 |
Gene ID |
10/D12 |
Gene synonyms/obsolete |
sft2 |
Gene product |
involved in
intracellular protein transport; involved in ER to Golgi
transport |
Entry clone |
Cloned |
ORF length (unspliced) |
815 |
ORF length (spliced) |
606 |
Entry clone length |
815 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1527.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGGAGTACGGTCTGA |
Rev primer name |
SPAC1527.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGGCAACCAGTTCGAAAGA |
Amino acid length |
201 |
Molecular weight |
22.6 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTTMERLPI/LSIVFGVLHI |
Localization (YFP) |
Golgi; vacuole
membrane |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |