Gene name |
SPAC26H5.13c |
Gene ID |
10/B01 |
Gene synonyms/obsolete |
|
Gene product |
conserved fungal
protein; sphingoid long chain base (LCB) kinase; similar to
S. cerevisiae YOR171C and YLR260W; 4 predicted
transmembrane helices |
Entry clone |
Cloned |
ORF length (unspliced) |
800 |
ORF length (spliced) |
711 |
Entry clone length |
800 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC26H5.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATTGTTTCGGCGTCC |
Rev primer name |
SPAC26H5.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACACGACTTCATCCATGAGT |
Amino acid length |
236 |
Molecular weight |
27.1 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LMYVSSVLML |
Localization (YFP) |
Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |