Gene name |
SPAC1142.07c |
Gene ID |
10/A03 |
Gene synonyms/obsolete |
vps32; snf7 |
Gene product |
SNF7 family; involved
in intracellular protein transport; involved in late endosome
to vacuole transport; involved in endosomal maturation; class
E vps |
Entry clone |
Cloned |
ORF length (unspliced) |
790 |
ORF length (spliced) |
669 |
Entry clone length |
790 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
713C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1142.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGGATTTTTAAGATG |
Rev primer name |
SPAC1142.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGAGAGAATTCAGCCTGT |
Amino acid length |
222 |
Molecular weight |
25.3 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytoplasmic dots |
Comments for localization |
aggregates by over
expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |