| Gene name |
SPAC1142.07c |
| Gene ID |
10/A03 |
| Gene synonyms/obsolete |
vps32; snf7 |
| Gene product |
SNF7 family; involved
in intracellular protein transport; involved in late endosome
to vacuole transport; involved in endosomal maturation; class
E vps |
| Entry clone |
Cloned |
| ORF length (unspliced) |
790 |
| ORF length (spliced) |
669 |
| Entry clone length |
790 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
713C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1142.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGGATTTTTAAGATG |
| Rev primer name |
SPAC1142.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGAGAGAATTCAGCCTGT |
| Amino acid length |
222 |
| Molecular weight |
25.3 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |